ADN mitochondrial et momies "aliens"

Article mis en ligne le 6 août 2017

logo imprimer

Mon correspondant généticien, qui s’était déjà intéressé aux résultats des analyses ADN communiqués par Thierry Jamin (voir cet article), a bien voulu me fournir le texte ci-dessous, qui revient sur ce qu’est l’ADN mitochondrial et sur ce qu’il permet d’apprendre - ou de ne pas apprendre - sur les momies de Nazca.

1. Intérêt de l’ADN mitochondrial en génétique humaine

1.1. Un petit génome haploïde

La mitochondrie est le siège de la respiration cellulaire, une des voies métaboliques permettant la transformation du glucose en énergie. C’est un composant de toutes les cellules à noyaux (i.e. eucaryotes), ce qui inclut les cellules humaines. On leur oppose toutes les cellules du monde bactérien, dépourvues aussi bien de noyau (i.e. procaryotes) et aussi de mitochondries – ainsi que, sauf rare exception, de tout autre organite.

Depuis les années 60 et les travaux de Lynn Margulis, il a été progressivement reconnu que la mitochondrie résultait de l’endosymbiose d’une cellule procaryote dans une autre cellule. C’est cet évènement qui aurait donné naissance à la lignée eucaryote.

Un des arguments majeurs est la présence d’un petit génome vestigial, encore répliqué de façon autonome par la mitochondrie (16kbases environ, à comparer aux 3900Mbases du génome humain chromosomique). Il s’agit bien de vestige : les fonctions codées par ce génome autonome sont bien trop peu nombreuses pour que la mitochondrie puisse être rencontrée sous une forme libre (la taille d’un génome bactérien est plutôt de l’ordre de 1Mb). Au cours de l’évolution, la majeure partie des gènes mitochondriaux ont été intégrés au génome chromosomique.

Une seule copie du génome mitochondrial est portée par chaque individu ; cette copie est transmise par l’ovule (on parle de transmission matrilinéaire). C’est donc un génome haploïde, ce qui l’apparente à celui des bactéries. Notre génome chromosomique, lui, est composé d’une copie issue de chacun des deux gamètes, donc diploïde.

1.2. Des marqueurs conservés, d’autres plus polymorphes

La structure du génome mitochondrial est très bien connue ; du fait de sa petite taille, son séquençage complet a pu être réalisé dés 1981 (c’était la « Cambridge Reference Sequence », décrite comme son nom l’indique à Cambridge par Fred Sanger).

Figure : la structure du génome mitochondrial humain. Source

Les gènes codant pour les sous-unités de l’enzyme cytochrome oxydase (gènes COI, COII, COIII), ou celui codant pour le cytochrome B (CYB) sont relativement conservés d’une espèce à l’autre. Pour cette raison ils ont donc fréquemment été utilisés pour comparer des espèces différentes (par exemple ici https://academic.oup.com/mbe/article/18/4/465/979709).

D’autres régions en revanche sont hypervariables (HVR1 et 2, HVR pour Hyper Variable Region). Elles accumulent des mutations à un rythme bien plus rapide ; elles se prêtent donc davantage à l’étude génétique à plus petite échelle, à l’intérieur d’une espèce et entre populations.

Une fois le marqueur choisi, il faut ensuite caractériser la version qu’en portent les individus du groupe étudié. Cette caractéristique est l’haplotype des individus. Les individus ayant des haplotypes très apparentés forment un haplogroupe.
Référence : Castresana, J. (2001). « Cytochrome b phylogeny and the taxonomy of great apes and mammals ». Molecular Biology and Evolution, 18(4), 465-471.

1.3. Histoire des haplotypes humains

Du fait de leur polymorphisme les HVR1 et 2 du génome mitochondrial ont été beaucoup utilisés pour comprendre les relations entre populations humaines. Grâce à ces marqueurs, on peut définir un petit nombre d’haplogroupes dans notre espèce (https://fr.wikipedia.org/wiki/Haplogroupe_X). Leur distribution, la fréquence de chacun de ces haplogroupes varie d’un endroit à l’autre de la planète (par exemple ici, la distribution de l’haplogroupe X en Europe : http://www.eupedia.com/europe/Haplogroupe_X_ADNmt.shtml).

Il est possible, en parallèle, d’étudier les relations d’apparentement entre ces haplogroupes. Pour simplifier, les séquences les plus ressemblantes ont plus de chances d’être apparentées (de partager les mêmes mutations). On peut ensuite construire la séquence ancestrale la plus probable ayant engendré ces deux apparentées (de la même façon qu’en zoologie, on définit notamment les mammifères par le comportement d’allaitement, ce qui vraisemblablement est une caractéristique de leur ancêtre commun).

De proche en proche, on peut finir par reconstruire l’ancêtre commun de tout un ensemble d’haplogroupes, ainsi que leurs relations génétiques. Dans le cas des haplogroupes mitochondriaux humains cet ancêtre commun a été baptisé « Ève mitochondriale » ; du fait de la transmission matrilinéaire du génome mitochondrial, remonter le passé revient à parcourir la lignée des mères.

La mise à jour de cette Ève moléculaire, l’haplogroupe L3, a apporté une confirmation génétique de l’origine africaine de l’homme : il s’agit en effet d’un groupe principalement rencontré chez les populations originaires d’Afrique de l’Est.

2. Exemple : le peuplement des Amériques par les Paléoindiens

Parmi d’autres résultats majeurs, cette approche a aussi jeté un jour nouveau sur l’histoire du peuplement initial (précolombien) des Amériques.

Il est désormais largement admis que le peuplement a été le fait de petits groupes humains passés d’Asie en Alaska par le détroit de Béring, à une période de glaciation où cette traversée était possible à pied sec. Ceci a dû se produire vers -15000 ans. Une certaine incertitude demeure sur le timing de cette migration, les sites archéologiques contemporains de cette période étant très rares (on peut citer le site Clovis aux États-Unis, vers -13000 ans et le site Monte Verde au Chili, -15000 ans).

Figure : Histoire de la migration des haplogroupes à travers le détroit de Béring - Source

La génétique a confirmé ce scénario. Elle a révélé que la quasi-totalité des Amérindiens contemporains appartenaient à un petit nombre d’haplogroupes autochtones, A2, B2, C1, D1 et X2a (cf Fagundes et al. 2008), déclinés en un certain nombre de sous-haplogroupes (Perego et al. (2010) en répertoriait 15). Leurs plus proches apparentés sont rencontrés en Asie du Nord-Est. Ceci plaide pour un petit nombre de fondateurs d’origine asiatique.

Les distributions différentes des B et X ont suggéré des hypothèses distinctes ; expansion plus tardive, peut-être vers -11000, de l’haplogroupe B2, suite à l’arrivée d’un nouveau groupe de migrants par le détroit de Béring, ou une émergence en Amérique du Nord ; pour l’haplogroupe X, une introduction depuis l’Europe à l’époque préhistorique.

Références :
- Brown, M. D., Hosseini, S. H., Torroni, A., Bandelt, H. J., Allen, J. C., Schurr, T. G., ... & Wallace, D. C. (1998). « mtDNA haplogroup X : an ancient link between Europe/Western Asia and North America ? ». The American Journal of Human Genetics, 63(6), 1852-1861.
- Fagundes, N. J., Kanitz, R., Eckert, R., Valls, A. C., Bogo, M. R., Salzano, F. M., ... & Santos, S. E. (2008).« Mitochondrial population genomics supports a single pre-Clovis origin with a coastal route for the peopling of the Americas ». The American Journal of Human Genetics, 82(3), 583-592.
- Perego, U. A., Angerhofer, N., Pala, M., Olivieri, A., Lancioni, H., Kashani, B. H., ... & Zimmermann, B. (2010). « The initial peopling of the Americas : a growing number of founding mitochondrial genomes from Beringia ». Genome Research, 20(9), 1174-1179.
- Starikovskaya, Y. B., Sukernik, R. I., Schurr, T. G., Kogelnik, A. M., & Wallace, D. C. (1998). « mtDNA diversity in Chukchi and Siberian Eskimos : implications for the genetic history of Ancient Beringia and the peopling of the New World ». The American Journal of Human Genetics, 63(5), 1473-1491.

3. Histoires possible des échantillons « Main » et « Crâne » de Thierry Jamin

3.1. Séquences disponibles  

Thierry Jamin et son équipe ont confié deux échantillons au prestataire Paleo-DNA, hébergé à l’Université de Lakehead au Canada. Il s’agit, d’après Thierry Jamin, d’échantillons collectés sur une « main » et sur un « crâne », dans lesquels plusieurs scientifiques ont cru reconnaître, respectivement, un assemblage d’os disparate et un crâne de chat fragmentaire. On peut aussi noter que la « main » a été datée (méthode C14) par deux laboratoires différents, l’un donnant un âge de 7000 ans environ, l’autre de 1200 ans.

Ces deux échantillons isolés ne semblent avoir aucun autre lien que leur site de prélèvement, au sud du Pérou. Le but poursuivi dans la comparaison de ces deux échantillons est assez obscur. Pour des raisons obscures également, Paleo-DNA a entrepris de réaliser, sur ces échantillons, un séquençage de la région 16191 -16420 de l’ADN mitochondrial humain (soit dans la partie terminale de ce génome qui fait exactement 16 569 bases). Ceci correspond aussi à une partie de la région HVR1, soit 190 bases sur 359.

Les séquences trouvées par Paleo-DNA ont été mises en ligne par l’équipe de Thierry Jamin :

- 1_crane
ACAGCAANCAACCCTCAACTATCACACATCAACTGCAACTCCAAAGCCACCCCTCACCCACT
AGGATACCAACAAACCTACCCACCCTTAACAGTACATAGTACATAAAGCCATTTACCGTACAT
AGCACATTACAGTCAAATCCCTTCTCGTCCCCATGGATGACCCCCCTCAGATAGGNGTCCCT
TGAC

- 2_main
TACAGCAATCAACCTTCAACTATCACACATCANCTGCAACTCCAAAGCCACCCCTCACCCACT
AGGATACCAACAAACCTACCCACCCTTAANAGTACATAGTACATAAAGCCATTTACCGTACAT
AGCACATNACAGTCAAATCCCTTCTCGNCCCCATGGATGACCCCCCTCAGATAGGGGTCCCT
TGA

Ce fragment d’HVR1 est trop court pour déterminer l’haplogroupe auquel appartient l’ADN présent dans les échantillons. On peut néanmoins émettre quelques hypothèses sur la base des résultats.

Deux autres séquençages (gènes 16S et 12S) ont été tentés, mais ne seront pas discutés ici : le 12S n’a pas pu être amplifié, et le 16S est moins informatif qu’HVR1 pour localiser les sources d’ADN.

3.2. « 98% Homo sapiens » : le problème des bases ambiguës

Le laboratoire Paleo-DNA a aligné les séquences produites de 190 bases à l’aide de BLASTn, un outil très populaire et rapide développé par le NCBI. Le NCBI étant un des grands instituts américains de la santé (version en ligne de BLASTn : https://blast.ncbi.nlm.nih.gov/Blast.cgi?PAGE_TYPE=BlastSearch). L’alignement de séquences consiste, ici, à comparer avec des millions de séquences déjà publiées et disponibles en ligne. Le résultat est habituellement donné en pourcentage : le « meilleur homologue » d’une séquence donnée S, dans l’état des connaissances à un instant t, présente un pourcentage d’identité X avec cette séquence S.

Ainsi, d’après le laboratoire Paléo-DNA, BLASTn a produit un alignement de 99% « avec Homo sapiens », pour chacune des séquences des « crâne » et « main ». Après vérification, ce sont effectivement presque 10 000 séquences homologues à 99% (« crâne ») et 98% (« main ») d’identité que l’on peut trouver, tous appartenant à Homo sapiens. Aucun homologue n’est trouvé dans une autre espèce connue.

Mais ce résultat appelle néanmoins une nuance. Une séquence est normalement composée des bases A, T, C, G, mais il arrive que le séquenceur ne puisse déterminer la base précise, auquel cas c’est un « N » qui est renseigné.

Figure : illustration de la notion base ambiguë : dans ce chromatogramme fictif, à la position 468, deux pics C et T sont superposés dans le chromatogramme. La base exacte ne peut être déterminée.

Or, BLASTn ne prend pas en compte ces bases dites ambiguës. Les séquences générées par le laboratoire PaleoDNA incluent un certain nombre d’ambiguïtés (environ 2/190 pour « crâne », 4/190 pour « main », soit respectivement 1% et 2% de N). Avec tant d’ambiguïtés, même un alignement de séquences issues d’échantillons strictement humains ne pouvait être que de 99%-98%, au maximum, avec cet outil. Pour expliquer ces ambiguïtés, le laboratoire Paleo-DNA évoque ici un ADN dégradé – ce qui, effectivement, doit être rencontré souvent dans le cas d’ADN ancien –, mais les chromatogrammes ne sont pas visibles et on peut suggérer d’autres hypothèses (cf 3.4.1).

Il faut noter qu’en aucun cas, ces 98%-99% ne peuvent être rapprochés du pourcentage de 98% d’identité estimée entre les génomes d’Homo sapiens et de chimpanzé. Car en effet, cette comparaison Homme-Chimpanzé (1) a été établie sur de l’ADN codant (et non sur des régions hypervariables), (2) avec des jeux de données de grande ampleur et non de courts fragments, (3) et surtout, les 2% de différence correspondent à des mutations bien réelles, non des imprécisions de séquençage. Pour mesurer ce que peut signifier une mutation réelle dans l’ADN codant, il suffit de songer aux nombreuses maladies génétiques graves déterminées par de simples mutations ponctuelles dans notre génome (i.e. la tristement célèbre mucoviscidose).

En comparaison, le polymorphisme dans la petite région HVR1 (0.00001% du génome humain !) n’a aucune conséquence sur le développement ou l’état de santé de l’individu, et les mutations s’y accumulent à un rythme très rapide.

3.3. Histoires extraterrestres possibles des échantillons

Les résultats précédents donnent certaines indications sur la nature des échantillons. Sous l’hypothèse extraterrestre, il faudrait admettre que le matériel d’origine :

- Contient de l’ADN, soit un polymère contenant ribose, adénosine, guanine, cytosine, thymine comme support de l’information pour la synthèse de biomolécules. Cet organisme dont est issu ce matériel présente une chimie carbonée, avec une biochimie basée sur le triptyque lipides/glucides/protides. La présence d’ADN mitochondrial confirme la capacité de réaliser la respiration cellulaire, qui implique des besoins en oxygène. La planète dont est issu cet organisme partage donc beaucoup de similarités avec la Terre (abondance du carbone, atmosphère avec oxygène).

- L’ADN suggère fortement une machinerie moléculaire identique à la nôtre, avec ADN, ARNm, synthèse de protéines. La recherche de la région HVR1, avec des outils dédiés à la génétique humaine, a fonctionné. Toutes les séquences homologues possibles ont été trouvées chez Homo sapiens.

L’organisme dont sont issus les échantillons nous ressemble donc énormément. L’ensemble de ces observations n’est compatible, a priori, qu’avec deux scénarios « extraterrestres » :

3.3.1. Ressemblance fortuite 
 
Quelque part dans l’Univers, la vie est apparue sous la forme d’un organisme quasiment identique à H. sapiens. Une rencontre s’est produite au Pérou, des hybrides ont été engendrés. Il faut ici imaginer que les millions d’évènements aléatoires qui ont mené à la lignée se sont produits ailleurs, à l’identique, selon un mode déterministe. Ceci contredit ce qu’on connaît de la vie sur Terre, où l’arbre de la vie ressemble plus à un foisonnement intense gouverné par le hasard. Des convergences évolutives ont été décrites, mais n’ont jamais généré de tels « réplicats évolutifs ».

3.3.2. Apparentement fort 
 
Un organisme extraterrestre est intervenu dans le cours de l’évolution de la vie sur Terre, peut-être dés l‘origine, ou peut-être uniquement en interaction avec le genre Homo. Des échanges génétiques continus ont eu lieu. L’apparentement entre Homo sp. et cet organisme est très élevé. Au Pérou on a peut-être la trace d’une hybridation, ou d’apparentement obtenu par biotechnologie. Dans ce scénario, on peut compléter ainsi le portrait robot de cette forme de vie extraterrestre : elle est très discrète, malgré ses interactions répétées avec le monde vivant terrestre, et très ancienne. Si elle fait de l’ingénierie biologique à grande échelle, elle est très patiente, déterminée, talentueuse et enfin montre un véritable sens du détail. Car nous partageons même avec elle HVR1, une région extrêmement courte (0.00001% du génome) et totalement inutile du point de vue fonctionnel. L’intervention est récente et fréquente, car cette région évolue vite ; pourtant, pour HVR1, il y a autant de différence entre nous et cette forme de vie qu’entre un Péruvien et un Japonais. S’il y a eu hybridation et échange de matériel génétique, c’est très fréquemment : on ne connaît à ce jour aucune autre espèce interféconde avec Homo sapiens. Décidément, cette forme de vie nous aime beaucoup. « Extra » terrestre est en fait un grand mot : après tous ses efforts, on pourrait quasiment la classer terrestre et Homo sapiens, à titre honorifique, et lui suggérer une rencontre amicale.

Ces deux scénarios paraissent si improbables, qu’on peut sans remord les écarter au profit de pistes plus terre à terre...

3.4. Histoires terrestres possibles des échantillons

Tout ce qui suit est clairement hypothétique, la quantité de données étant très réduite (deux courtes séquences de 190 bases, avec de nombreuses ambiguïtés).

Pour aller au-delà de l’alignement par BLASTn, les deux séquences générées ont été réalignées à l’aide du logiciel CLUSTALW (inclus dans le logiciel polyvalent MEGA7) et analysées de façon à reconstruire les relations d’apparentement génétiques sous ce même logiciel (distance Tamura and Nei, avec le paramètre de correction gamma=0.26 suggéré pour HVR1 par Meyer et al., 1999 ; construction du dendrogramme par Neighbor Joining).
Référence : Meyer S, Weiss G, von Haeseler A. 1999. « Pattern of nucleotide substitution and rate heterogeneity in the hypervariable regions I and II of human mtDNA ». Genetics 152:1103–1110

D’autres séquences déjà publiées, d’haplogroupes connus, ont été intégrées à la comparaison. Un accent tout particulier a été mis sur des séquences d’haplogroupes et sous haplogroupes d’Amérindiens et Paleoindiens, afin d’optimiser nos chances de démêler les liens entre les sources d’ADN des échantillons et leurs probables apparentés. D’autres haplogroupes rencontrés en Europe, Asie et Afrique ont aussi été intégrés à la comparaison. Toutes ces séquences sont disponibles en ligne via le portail web MitoTool.

Figure : arbre phylogénétique reconstruit incluant les séquences issues des échantillons « crâne » et « main » ainsi que des séquences publiées d’haplogroupes connus (A en rouge, B vert clair, C en vert foncé, D en bleu ciel et X en violet étant les haplogroupes rencontrés chez les Amérindiens).

Même si l’alignement porte sur un fragment d’HVR1, les relations génétiques de ces différents haplogroupes, et le regroupement des séquences par haplogroupe sont en bonne partie correctes. On peut comparer cet arbre à ce qui est admis sur les relations d’apparentement entre haplogroupes sur la base de jeux de données bien plus conséquents :

Figure : relations génétiques entre haplogroupes humains - Source

3.4.1. Échantillon « main »

Par comparaison avec la séquence de référence de l’alignement, ici la séquence « Cambridge Reference Sequence », la séquence présente plusieurs sites polymorphes intéressants (aux positions 16223, 16241, 16301, 16342, 16362). Dans nos données, seul l’haplogroupe D4H3a présente ce polymorphisme très particulier (voir sa description par Kemp et al. en 2007). Cet haplogroupe serait donc ici le meilleur homologue de notre séquence.
Référence : Kemp, B. M., Malhi, R. S., McDonough, J., Bolnick, D. A., Eshleman, J. A., Rickards, O., ... & Fifield, T. E. (2007). « Genetic analysis of early Holocene skeletal remains from Alaska and its implications for the settlement of the Americas ». American Journal of Physical Anthropology, 132(4), 605-621.

L’haplogroupe D4H3a est spécifique des Paléoindiens qui ont peuplé les Amériques vers -15000. On le rencontre surtout en Amérique du Sud suite à l’expansion ultérieure de B2 en Amérique du Nord. Cet haplogroupe se rencontrait donc au sud du Pérou aux deux dates annoncées par les datations au carbone 14 (7000 et 1200 ans). Conformément aux datations, il semble ici qu’on a affaire à un échantillon d’ADN issu d’un individu Paléo- ou Amérindien, peut-être ancien.

Néanmoins, il faut noter que pour tous ces sites polymorphes – et uniquement ceux-là –, le polymorphisme relève d’une ambiguïté de séquençage. Ceci n’est peut-être pas fortuit. Si l’échantillon contient deux sources d’ADN distinctes, en quantité égales, appartenant à deux haplogroupes, le séquençage sera ambigu sur tous les sites polymorphes permettant de les distinguer. Ce pourrait donc être une explication ici : on serait en présence de deux sources d’ADN, l’une d’haplogroupe D4H3a. Quant à l’autre, beaucoup d’haplogroupes, y compris amérindiens, pourraient donner ce résultat. Impossible de l’identifier sans examen du chromatogramme. 

Cette hypothèse à deux sources expliquerait que deux dates différentes ont été trouvées en datation. La contamination par de multiples sources d’ADN est un risque évident à prendre en compte lorsqu’on manipule des échantillons humains anciens sur le terrain. Or il n’est pas assuré que toutes les précautions ont été prises par Thierry Jamin et son équipe. Le laboratoire Paleo-DNA stipule bien que rien ne lui a été fourni pour réaliser les contrôles nécessaires, ce qui ne plaide pas pour la rigueur scientifique des participants de l’ « Alien Project ».

3.4.2. Échantillon « crâne »

Les séquences apparentées à celle de l’échantillon crâne sont de l’haplogroupe B2, très fréquent chez les Amérindiens actuels notamment au Mexique et en Amérique Centrale. Des analyses ultérieures, non montrées, ont effectivement révélé que la séquence se branchait entre l’origine du groupe B, répandu dans toute l’Asie, et les haplogroupes amérindiens dérivés de B2. Là encore, on aurait donc bel et bien affaire à du matériel humain issu d’un individu Amérindien contemporain ou Paléoindien B2. Aucune datation n’a été réalisée pour cet échantillon.

3.4.3. Conclusion

Une falsification à base d’ADN d’individus amérindiens vivants est possible ici. De même qu’il est possible que des momies précolombiennes, plus ou moins anciennes, aient été échantillonnées et soumises au séquençage. Ceci soulève à nouveau la question de la destruction de ce matériel archéologique authentique pour réaliser un canular.


Forum
Répondre à cet article
ADN mitochondrial et momies "aliens"
Camilo Moreno - le 6 août 2017

Excellent travail, bravo, nous aurions aimé tenir cela de AP puisque ça le concerne directement, ce qui immanquablement aurait joué en sa faveur, mais bon, heureusement que vous êtes là à prendre sur votre temps à titre bénévole pour éclairer les gens. Merci à vous.

ADN mitochondrial et momies "aliens"
Camilo Moreno - le 6 août 2017

dimanche 6 août 2017 à 22h38 - par Irna

@Camilo Moreno :

...et finalement, la séquence des "ET" se rapprocherait d’un haplogroupe amérindien ?

Oui, c’est tout à fait ça ; ou plutôt de deux haplogroupes différents, l’un qui est probablement paléoindien pour la main, l’autre qui pourrait être un amérindien contemporain ou un paléoindien plus récent pour le crâne. Rien de plus conclusif, si ce n’est bien sûr qu’on peut exclure les aliens :)

Merci pour la réponse. En fait, la séquence ADN de "ET" est du genre "déjà vu" , merci à vous et aussi au généticien qui s’est donné la peine de faire la comparaison.

ADN mitochondrial et momies "aliens"
L.Despoutres - le 6 août 2017

Merci à vous pour cet article clair et compréhensible.

ADN mitochondrial et momies "aliens"
Camilo Moreno - le 6 août 2017

...et finalement, la séquence des "ET" se rapprocherait d’un haplogroupe amérindien ?

ADN mitochondrial et momies "aliens"
L.Despoutres - le 6 août 2017

D’après ce que j’ai compris, oui.

ADN mitochondrial et momies "aliens"
Camilo Moreno - le 6 août 2017

dimanche 6 août 2017 à 19h53 - par L.Despoutres

D’après ce que j’ai compris, oui.

Moi aussi, mais je ne suis pas sûr de cela, vu que mes connaissances de ce domaine sont faibles. Je serais reconnaissant à Irna, si elle peut nous le confirmer

ADN mitochondrial et momies "aliens"
Irna - le 6 août 2017

@L.Despoutres : merci surtout à ce généticien qui a gentiment pris le temps d’expliquer tout cela et de procéder à l’analyse de ces séquences !

@Camilo Moreno :

...et finalement, la séquence des "ET" se rapprocherait d’un haplogroupe amérindien ?

Oui, c’est tout à fait ça ; ou plutôt de deux haplogroupes différents, l’un qui est probablement paléoindien pour la main, l’autre qui pourrait être un amérindien contemporain ou un paléoindien plus récent pour le crâne. Rien de plus conclusif, si ce n’est bien sûr qu’on peut exclure les aliens :)



pucePlan du site puceContact puceEspace rédacteurs puce

RSS Valid XHTML 1.0 Strict

2006-2017 © Le site d’Irna - Tous droits réservés
Site réalisé sous SPIP
avec le squelette ESCAL-V3
Version : 3.87.47
amélioré par Pigédius
Hébergeur : L'Autre Net